ORK10393

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10393

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10393
Clone name	bn02156
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PEBP1
cDNA sequence	DNA sequence (1036 bp) Predicted protein sequence (222 aa)
HaloTag ORF Clone	FHC10393
Flexi ORF Clone	FXC10393
Description	Phosphatidylethanolamine-binding protein 1 (PEBP-1)(Prostatic-binding protein)(HCNPpp)(Neuropolypeptide h3)(Raf kinase inhibitor protein)(RKIP) [Contains Hippocampal cholinergic neurostimulating peptide(HCNP)]

Features of the cloned cDNA sequence

Description

Length: 1036 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	365 bp
Genome contig ID	gi89161190f_116958291
PolyA signal sequence (None)	+--------+--------+----*----+---- AGAGCAAAGCATCAAAGAATCTTTAAGGGAGGTTT
Flanking genome sequence (109067 - 109116)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGATTGGTTGCCTCTGCCTTTGTGATCCTG

Features of the protein sequence

Description

Length: 222 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_509413	1.8e-95	99.0	similar to phos...	Pan troglodytes
P30086	5.2e-80	100.0	Phosphatidyleth...	Homo sapiens
AAB32876	1.5e-79	100.0	neuropolypeptid...	Homo sapiens
Q5R4R0	3.4e-79	98.9	Phosphatidyleth...	Pongo abelii
P48737	4.8e-78	97.8	Phosphatidyleth...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008914	41	222	PD004330	PEBP
HMMPfam	IPR008914	52	207	PF01161	PEBP
ScanRegExp	IPR001858	99	121	PS01220	Phosphatidylethanolamine-binding protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp