Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10397
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10397
Clone name ef02192
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ACOT9
cDNA sequence DNA sequence (3056 bp)
Predicted protein sequence (463 aa)
Flexi ORF Clone FXC10397
Description Acyl-coenzyme A thioesterase 9 (Acyl-CoA thioesterase 9)(EC 3.1.2.-)(Acyl-CoA thioester hydrolase 9)
Features of the cloned cDNA sequence

Length: 3056 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1622 bp
Genome contig ID gi89161218r_23530589
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGTGACAGAACGAGACTCCATCTC
Flanking genome sequence
(99721 - 99672)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAATCTGTAGCCAAGACCGTTCCTTTTTTGAC

Features of the protein sequence

Length: 463 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_001032248 1.7e-193 100.0 acyl-coenzyme A...
Homo sapiens
XP_520975 2e-193 99.7 acyl-Coenzyme A...
Pan troglodytes
XP_001087741 2.7e-172 91.5 similar to acyl...
Macaca mulatta
Q9Y305 1.2e-171 97.9 Acyl-coenzyme A...
Homo sapiens
AAD27725 1.2e-170 100.0 CGI-16 protein ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp