Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10398
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10398
Clone name eg00592
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PCM1
cDNA sequence DNA sequence (6738 bp)
Predicted protein sequence (2074 aa)
Description Pericentriolar material 1 protein (PCM-1)(hPCM-1)
Features of the cloned cDNA sequence

Length: 6738 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 93 bp
Genome contig ID gi51511724f_17724619
PolyA signal sequence
(AATAAA,-28)		 
+----*----+----*----+----*----+----
AATACTAAATAAACATCTGATCTGTATAAAAATGT
Flanking genome sequence
(204927 - 204976)		 
----+----*----+----*----+----*----+----*----+----*
AAATTAGTTTGACACTGCTTTTTTGATAGGTGTGGTCATTTCTCCCCATG

Features of the protein sequence

Length: 2074 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW63797 0 99.9 pericentriolar ...
 Homo sapiens
XP_001143594 0 99.1 pericentriolar ...
 Pan troglodytes
XP_519627 0 98.7 pericentriolar ...
 Pan troglodytes
XP_001143445 0 97.7 pericentriolar ...
 Pan troglodytes
XP_856635 0 91.3 similar to peri...
 Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR000572 625 660 PS00559 Oxidoreductase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp