Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10404
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10404
Clone name fg04635
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FAM212B
cDNA sequence DNA sequence (5933 bp)
Predicted protein sequence (341 aa)
Flexi ORF Clone FXC10404
Description Uncharacterized protein C1orf183
Features of the cloned cDNA sequence

Length: 5933 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4905 bp
Genome contig ID gi89161185r_111966209
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CCCAACCCCTAAAATAAACAGTATGATGAAACCTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCTTCCAGATTCCCTCTGAATTTGACAGAGGACGTACTTCCTGGCTCTCT

Features of the protein sequence

Length: 341 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NTI7 1.8e-116 100.0 Uncharacterized...
Homo sapiens
XP_001158486 2e-109 97.0 similar to Chro...
Pan troglodytes
CAB69909 2.1e-109 99.2 hypothetical pr...
Homo sapiens
EAW56504 6.4e-109 100.0 chromosome 1 op...
Homo sapiens
A6QP24 7.5e-91 84.0 Uncharacterized...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp