ORK10407

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10407

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10407
Clone name	fh09009
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh09009 has an irregular adapter sequence (GTCGACCCAC GCGTCCGGAG G) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	CCSAP
cDNA sequence	DNA sequence (5179 bp) Predicted protein sequence (307 aa)
Description	Uncharacterized protein C1orf96

Features of the cloned cDNA sequence

Description

Length: 5179 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4220 bp
Genome contig ID	gi89161185r_227423386
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TACTTGGAAAAATGTGAATAAAGTTAATTAACATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAAGCTGAGACTCTTTTGTGAGAAGTAATTCTGCTTAGTACATAAATGA

Features of the protein sequence

Description

Length: 307 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q6IQ19	2.1e-83	100.0	Uncharacterized...	Homo sapiens
AAH71609	6.6e-83	99.6	Chromosome 1 op...	Homo sapiens
XP_001082858	1.6e-81	97.7	hypothetical pr...	Macaca mulatta
XP_001146289	1.8e-81	97.4	similar to Chro...	Pan troglodytes
XP_001928218	2.5e-66	80.8	similar to Unch...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp