ORK10412

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10412

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10412
Clone name	fh25612
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CACHD1
cDNA sequence	DNA sequence (5675 bp) Predicted protein sequence (1230 aa)
Description	VWFA and cache domain-containing protein 1 Precursor (Cache domain-containing protein 1)

Features of the cloned cDNA sequence

Description

Length: 5675 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1491 bp
Genome contig ID	gi89161185f_64644202
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATTGCAATCTAGTGAAATAAACCGTATGCAATGG
Flanking genome sequence (287123 - 287172)	----+--------+--------+--------+--------+----* ACCATTTTAGTGGCTACAGTGATTTGTTAATGTACCACTCCTTGTGCCTC

Features of the protein sequence

Description

Length: 1230 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX06551	99.9	cache domain co...	Homo sapiens
CAH70309	99.7	cache domain co...	Homo sapiens
Q5VU97	99.7	VWFA and cache ...	Homo sapiens
XP_001089910	98.8	similar to von ...	Macaca mulatta
XP_536680	98.9	similar to von ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013608	45	160	PF08399	VWA N-terminal
	IPR002035	184	379	PF00092	von Willebrand factor
	IPR004010	409	488	PF02743	Cache
	IPR004010	728	809	PF02743	Cache
ProfileScan	IPR002035	184	399	PS50234	von Willebrand factor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2	SGSVPNSLCVLLCLIFPTTNERI	24	SECONDARY	23
SOSUI2	2	1052	VGPVAGGIMGCIMVLVLAVYAYR	1074	PRIMARY	23