Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10422
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10422
Clone name ha00552
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of th ...
Symbol CKAP5
cDNA sequence DNA sequence (6637 bp)
Predicted protein sequence (2038 aa)
Description Cytoskeleton-associated protein 5 (Colonic and hepatic tumor over-expressed protein)(Ch-TOG protein)
Features of the cloned cDNA sequence

Length: 6637 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 477 bp
Genome contig ID gi51511727r_46621667
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AAGAGTCTTTTATAAATAAAGTTTGCATTAACTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCTGACTCCCAAGATGCTCCATATCATGGAGTGTTGGGCAGCAATTTTT

Features of the protein sequence

Length: 2038 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q14008 0 100.0 Cytoskeleton-as...
Homo sapiens
XP_001165782 0 99.8 colonic and hep...
Pan troglodytes
XP_001165753 0 99.3 colonic and hep...
Pan troglodytes
XP_508402 0 99.5 colonic and hep...
Pan troglodytes
XP_001915280 0 96.9 cytoskeleton as...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000357 440 476 PF02985 HEAT
IPR000357 1020 1055 PF02985 HEAT
IPR000357 1367 1403 PF02985 HEAT
ProfileScan IPR000357 446 484 PS50077 HEAT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp