Length: 10017 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
9459 bp |
Genome contig ID |
gi89161185f_182613141 |
PolyA signal sequence (ATTAAA,-17) |
+----*----+----*----+----*----+---- TTTGACATTGGACTTTCTATTAAATAATTTTTAAG |
Flanking genome sequence (251633 - 251682) |
----+----*----+----*----+----*----+----*----+----* AGTTGGCCTGGCTTTGTTCTCTTTTATGTCTTTCTTCTTTCCTTTCTCAT |
Length: 125 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
Q9H246 |
4e-44 |
99.1 |
Uncharacterized...
|
Homo sapiens
|
AAI33419 |
4.6e-44 |
98.3 |
Chromosome 1 op...
|
Bos taurus
|
Q8K207 |
3.9e-43 |
95.8 |
Uncharacterized...
|
Mus musculus
|
EDM09566 |
4.5e-43 |
95.8 |
similar to RIKE...
|
Rattus norvegicus
|
XP_422292 |
2.4e-42 |
92.5 |
similar to C1or...
|
Gallus gallus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.