Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10424
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10424
Clone name ha06115
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol C1orf21
cDNA sequence DNA sequence (10017 bp)
Predicted protein sequence (125 aa)
Description Uncharacterized protein C1orf21 (Cell proliferation-inducing gene 13 protein)
Features of the cloned cDNA sequence

Length: 10017 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 9459 bp
Genome contig ID gi89161185f_182613141
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
TTTGACATTGGACTTTCTATTAAATAATTTTTAAG
Flanking genome sequence
(251633 - 251682)
----+----*----+----*----+----*----+----*----+----*
AGTTGGCCTGGCTTTGTTCTCTTTTATGTCTTTCTTCTTTCCTTTCTCAT

Features of the protein sequence

Length: 125 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9H246 4e-44 99.1 Uncharacterized...
Homo sapiens
AAI33419 4.6e-44 98.3 Chromosome 1 op...
Bos taurus
Q8K207 3.9e-43 95.8 Uncharacterized...
Mus musculus
EDM09566 4.5e-43 95.8 similar to RIKE...
Rattus norvegicus
XP_422292 2.4e-42 92.5 similar to C1or...
Gallus gallus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp