ORK10474

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10474

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10474
Clone name	ee17314
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	TFE3
cDNA sequence	DNA sequence (3265 bp) Predicted protein sequence (611 aa)
HaloTag ORF Clone	FHC10474
Flexi ORF Clone	FXC10474
Description	transcription factor binding to IGHM enhancer 3

Features of the cloned cDNA sequence

Description

Length: 3265 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1429 bp
Genome contig ID	gi89161218r_48671184
PolyA signal sequence (None)	+--------+--------+----*----+---- AAGCTAGGCGTGTTTGATGCGCTTTTAACTTTGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAGTCTCCTGTCCTTGTTTTACACTGTGCAGTGAACATAGCCCATGC

Features of the protein sequence

Description

Length: 611 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P19532	1.5e-179	100.0	Transcription f...	Homo sapiens
XP_001105073	9.5e-179	99.4	similar to Tran...	Macaca mulatta
BAG36317	1.3e-178	99.6	unnamed protein...	Homo sapiens
XP_001494946	1e-175	97.7	similar to Tran...	Equus caballus
CAM13595	3.3e-171	95.8	transcription f...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001092	383	436	PF00010	Basic helix-loop-helix dimerisation region bHLH
HMMSmart	IPR001092	388	441	SM00353	Basic helix-loop-helix dimerisation region bHLH
ProfileScan	IPR001092	380	436	PS50888	Basic helix-loop-helix dimerisation region bHLH
ScanRegExp	IPR001412	508	518	PS00178	Aminoacyl-tRNA synthetase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp