Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10483
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10483
Clone name ee21768
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol NR3C1
cDNA sequence DNA sequence (3171 bp)
Predicted protein sequence (780 aa)
Flexi ORF Clone FXC10483
Description nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)
Features of the cloned cDNA sequence

Length: 3171 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 751 bp
Genome contig ID gi51511721r_142540896
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
CACAAAAATTGACTCAAATCTCCAGTATTCTTGTC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAGCTCATATTTTGTATATATCTGCTTCAGTGGA

Features of the protein sequence

Length: 780 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P04150 0 100.0 Glucocorticoid ...
 Homo sapiens
BAD97314 0 99.8 nuclear recepto...
 Homo sapiens
CAE45716 0 99.8 hypothetical pr...
 Homo sapiens
AAA16603 0 99.8 glucocorticoid ...
 Homo sapiens
BAH02307 0 99.7 glucocorticoid ...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001628 423 490 PD000035 Zinc finger
FPrintScan IPR001409 29 49 PR00528 Glucocorticoid receptor
IPR001409 79 99 PR00528 Glucocorticoid receptor
IPR001409 112 132 PR00528 Glucocorticoid receptor
IPR001409 278 299 PR00528 Glucocorticoid receptor
IPR001409 325 343 PR00528 Glucocorticoid receptor
IPR001409 385 404 PR00528 Glucocorticoid receptor
IPR001628 424 440 PR00047 Zinc finger
IPR001628 440 455 PR00047 Zinc finger
IPR001628 473 481 PR00047 Zinc finger
IPR001628 481 489 PR00047 Zinc finger
IPR001723 485 495 PR00398 Steroid hormone receptor
IPR001723 569 590 PR00398 Steroid hormone receptor
IPR001723 590 606 PR00398 Steroid hormone receptor
IPR001723 659 674 PR00398 Steroid hormone receptor
HMMPfam IPR001409 29 404 PF02155 Glucocorticoid receptor
IPR001628 422 497 PF00105 Zinc finger
IPR000536 571 759 PF00104 Nuclear hormone receptor
HMMSmart IPR001628 421 492 SM00399 Zinc finger
IPR000536 568 732 SM00430 Nuclear hormone receptor
ProfileScan IPR001628 421 496 PS51030 Zinc finger
ScanRegExp IPR001628 424 450 PS00031 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp