Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10490
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10490
Clone name ee06549
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol HID1
cDNA sequence DNA sequence (3254 bp)
Predicted protein sequence (808 aa)
Flexi ORF Clone FXC10490
Description chromosome 17 open reading frame 28
Features of the cloned cDNA sequence

Length: 3254 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 825 bp
Genome contig ID gi51511734r_70358435
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ACAATCGGCCTCTTTACAATAAAACCTCCTGCTCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATTCTGACTCTGTGGTTGAGGCGAGGGGCCAGGTGTGGCTCTTGTCTT

Features of the protein sequence

Length: 808 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q8IV36 0 100.0 UPF0663 transme...
Homo sapiens
EAW89220 0 98.9 chromosome 17 o...
Homo sapiens
EAW89218 0 98.9 chromosome 17 o...
Homo sapiens
XP_511668 0 95.6 similar to Chro...
Pan troglodytes
EDL34477 0 95.6 RIKEN cDNA C630...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp