Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11643
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11643
Clone name hj02718
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MAMLD1
cDNA sequence DNA sequence (4815 bp)
Predicted protein sequence (791 aa)
Flexi ORF Clone FXC11643
Description mastermind-like domain containing 1
Features of the cloned cDNA sequence

Length: 4815 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2210 bp
Genome contig ID gi89161218f_149180998
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
TGTTTTTTCTTCGTTCTGTAATAAACAGCCAGGAG
Flanking genome sequence
(252101 - 252150)
----+----*----+----*----+----*----+----*----+----*
AAAAGTGCCTCTATGTTTTTATTTTTCAAGGGAGTATTCAGTACCTACAA

Features of the protein sequence

Length: 791 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q13495 2.6e-203 99.8 Mastermind-like...
Homo sapiens
XP_521302 3.1e-202 99.3 similar to orf ...
Pan troglodytes
AAI36325 1.8e-187 96.6 MAMLD1 protein ...
Homo sapiens
BAG37651 2.1e-182 99.7 unnamed protein...
Homo sapiens
AAC50551 6.4e-181 99.2 orf [Homo sapiens].
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp