ORK11782

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11782

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11782
Clone name	bm02924
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	TPM3
cDNA sequence	DNA sequence (2082 bp) Predicted protein sequence (268 aa)
HaloTag ORF Clone	FHC11782
Flexi ORF Clone	FXC11782
Description	Tropomyosin alpha-3 chain (Tropomyosin-3)(Gamma-tropomyosin)(Tropomyosin-5)(hTM5)

Features of the cloned cDNA sequence

Description

Length: 2082 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1273 bp
Genome contig ID	gi89161185r_152295466
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CAAGTGTCTTTTTGAAATAAAGAACCAGTCCCTCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCCTCAGACCTATTTGACTTTTATTTATTAAAACTAAATGTGCTTTCT

Features of the protein sequence

Description

Length: 268 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAH71267	7.6e-64	100.0	tropomyosin 3 [...	Homo sapiens
XP_001365720	1.2e-63	99.5	similar to Trop...	Monodelphis dom...
XP_001496152	1.5e-63	99.5	similar to trop...	Equus caballus
CAH93139	1.5e-63	99.5	hypothetical pr...	Pongo abelii
BAE87388	1.5e-63	99.5	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000533	68	85	PR00194	Tropomyosin
	IPR000533	104	124	PR00194	Tropomyosin
	IPR000533	129	157	PR00194	Tropomyosin
	IPR000533	159	182	PR00194	Tropomyosin
	IPR000533	215	240	PR00194	Tropomyosin
HMMPfam	IPR000533	32	268	PF00261	Tropomyosin
ScanRegExp	IPR000533	216	224	PS00326	Tropomyosin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp