Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11807
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11807
Clone name fh02118
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FAM168B
cDNA sequence DNA sequence (5415 bp)
Predicted protein sequence (232 aa)
Flexi ORF Clone FXC11807
Description UPF0541 protein FAM168B (p20)
Features of the cloned cDNA sequence

Length: 5415 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4588 bp
Genome contig ID gi89161199r_131421920
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TACTGCAGTTTTCAATAAAGATTGACTTGTGTTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATATTGTGGTTTTCATGATTTCTCCATATGGGTTTTTGTCTAGAGGTAGC

Features of the protein sequence

Length: 232 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI10643 1.3e-59 99.4 FAM168B protein...
Homo sapiens
XP_422581 1.8e-59 97.9 hypothetical pr...
Gallus gallus
Q80XQ8 7e-59 98.4 Protein FAM168B.
Mus musculus
BAE25820 1.9e-58 97.9 unnamed protein...
Mus musculus
XP_001915297 5.2e-57 94.3 hypothetical pr...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp