Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11830
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11830
Clone name hg04921
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CHIC1
cDNA sequence DNA sequence (6889 bp)
Predicted protein sequence (263 aa)
Flexi ORF Clone FXC11830
Description Cysteine-rich hydrophobic domain 1 protein (Brain X-linked protein)
Features of the cloned cDNA sequence

Length: 6889 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 6095 bp
Genome contig ID gi89161218f_72599727
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GGATGCAAATTTAAAATAAAGTGTAAATCTATGTT
Flanking genome sequence
(223935 - 223984)
----+----*----+----*----+----*----+----*----+----*
AATGAATTGAATTCTGTGTTTTTTTTATGCATCTTCCTTTCTTCCCTTCC

Features of the protein sequence

Length: 263 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_521135 6.8e-82 98.7 similar to cyst...
Pan troglodytes
XP_001056014 9.1e-80 91.1 similar to cyst...
Rattus norvegicus
Q5VXU3 1.1e-75 100.0 Cysteine-rich h...
Homo sapiens
XP_001095379 6.4e-74 98.6 similar to Cyst...
Macaca mulatta
XP_871862 1.6e-73 97.3 similar to cyst...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp