Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11841
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11841
Clone name pj01468
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZKSCAN5
cDNA sequence DNA sequence (3989 bp)
Predicted protein sequence (841 aa)
Description Zinc finger protein with KRAB and SCAN domains 5 (Zinc finger protein 95 homolog)(Zfp-95)
Features of the cloned cDNA sequence

Length: 3989 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1209 bp
Genome contig ID gi89161213f_98840073
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTACAATAAATGCCCAATAAATATTTGTTGACCAT
Flanking genome sequence
(128946 - 128995)
----+----*----+----*----+----*----+----*----+----*
ATGTGTTGTACACTGTGGTGCCCTGTCCAGTCCCCTCTACCAAGCTGAGA

Features of the protein sequence

Length: 841 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9Y2L8 0 100.0 Zinc finger pro...
Homo sapiens
AAH30790 0 99.8 ZKSCAN5 protein...
Homo sapiens
BAG51370 0 99.7 unnamed protein...
Homo sapiens
A2T7D2 0 99.6 Zinc finger pro...
Pan troglodytes
XP_001505067 0 90.7 similar to Zinc...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 348 371 PD000003 Zinc finger
IPR007087 376 399 PD000003 Zinc finger
IPR007087 432 454 PD000003 Zinc finger
IPR007087 551 574 PD000003 Zinc finger
IPR007087 579 602 PD000003 Zinc finger
IPR007087 607 630 PD000003 Zinc finger
IPR007087 635 658 PD000003 Zinc finger
IPR007087 719 742 PD000003 Zinc finger
IPR007087 775 798 PD000003 Zinc finger
HMMPfam IPR003309 46 141 PF02023 Transcriptional regulator SCAN
IPR001909 223 260 PF01352 KRAB box
IPR007087 348 370 PF00096 Zinc finger
IPR007087 376 398 PF00096 Zinc finger
IPR007087 404 426 PF00096 Zinc finger
IPR007087 432 454 PF00096 Zinc finger
IPR007087 551 573 PF00096 Zinc finger
IPR007087 579 601 PF00096 Zinc finger
IPR007087 607 629 PF00096 Zinc finger
IPR007087 635 657 PF00096 Zinc finger
IPR007087 663 685 PF00096 Zinc finger
IPR007087 719 741 PF00096 Zinc finger
IPR007087 775 797 PF00096 Zinc finger
IPR007087 803 825 PF00096 Zinc finger
HMMSmart IPR003309 48 157 SM00431 Transcriptional regulator SCAN
IPR001909 220 283 SM00349 KRAB box
IPR015880 348 370 SM00355 Zinc finger
IPR015880 376 398 SM00355 Zinc finger
IPR015880 404 426 SM00355 Zinc finger
IPR015880 432 454 SM00355 Zinc finger
IPR015880 551 573 SM00355 Zinc finger
IPR015880 579 601 SM00355 Zinc finger
IPR015880 607 629 SM00355 Zinc finger
IPR015880 635 657 SM00355 Zinc finger
IPR015880 663 685 SM00355 Zinc finger
IPR015880 719 741 SM00355 Zinc finger
IPR015880 775 797 SM00355 Zinc finger
IPR015880 803 825 SM00355 Zinc finger
ProfileScan IPR003309 53 134 PS50804 Transcriptional regulator SCAN
IPR001909 220 293 PS50805 KRAB box
IPR007087 348 375 PS50157 Zinc finger
IPR007087 376 403 PS50157 Zinc finger
IPR007087 404 431 PS50157 Zinc finger
IPR007087 432 459 PS50157 Zinc finger
IPR007087 551 578 PS50157 Zinc finger
IPR007087 579 606 PS50157 Zinc finger
IPR007087 607 634 PS50157 Zinc finger
IPR007087 635 662 PS50157 Zinc finger
IPR007087 663 690 PS50157 Zinc finger
IPR007087 719 746 PS50157 Zinc finger
IPR007087 747 774 PS50157 Zinc finger
IPR007087 775 802 PS50157 Zinc finger
IPR007087 803 830 PS50157 Zinc finger
ScanRegExp IPR007087 350 370 PS00028 Zinc finger
IPR007087 378 398 PS00028 Zinc finger
IPR007087 406 426 PS00028 Zinc finger
IPR007087 434 454 PS00028 Zinc finger
IPR007087 553 573 PS00028 Zinc finger
IPR007087 581 601 PS00028 Zinc finger
IPR007087 609 629 PS00028 Zinc finger
IPR007087 637 657 PS00028 Zinc finger
IPR007087 665 685 PS00028 Zinc finger
IPR007087 721 741 PS00028 Zinc finger
IPR007087 777 797 PS00028 Zinc finger
IPR007087 805 825 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp