Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11848
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11848
Clone name bn02161
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ECI1
cDNA sequence DNA sequence (993 bp)
Predicted protein sequence (301 aa)
Flexi ORF Clone FXC11848
Description 3,2-trans-enoyl-CoA isomerase, mitochondrial Precursor (EC 5.3.3.8)(Dodecenoyl-CoA isomerase)(Delta(3),Delta(2)-enoyl-CoA isomerase)(D3,D2-enoyl-CoA isomerase)
Features of the cloned cDNA sequence

Length: 993 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 86 bp
Genome contig ID gi51511732r_2129895
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GAGGTCTTAAACAAGGTATTTTTCAACTTAAAAGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTGCCAGCGTTTCATTTTGCTGATGTTACGTAGAAGTTCCTGTTCCTCA

Features of the protein sequence

Length: 301 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P42126 1.5e-122 100.0 3,2-trans-enoyl...
Homo sapiens
AAH00762 6e-122 99.6 Dodecenoyl-Coen...
Homo sapiens
CAA81065 2.4e-121 99.3 dodecenoyl-CoA ...
Homo sapiens
1SG4 2.9e-105 100.0 3,2-trans-enoyl...
Homo sapiens
AAA35485 1e-103 97.3 delta3, delta2-...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001753 57 227 PF00378 Crotonase
ScanRegExp IPR001753 142 162 PS00166 Crotonase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp