Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11852
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11852
Clone name fh17570s1
Vector information
The cDNA fragment was inserted at the XhoI-NotI site of the ...
Symbol TNRC6A
cDNA sequence DNA sequence (6958 bp)
Predicted protein sequence (1961 aa)
Description Trinucleotide repeat-containing gene 6A protein (CAG repeat protein 26)(Glycine-tryptophan protein of 182 kDa)(GW182 autoantigen)(Protein GW1)(EMSY interactor protein)
Features of the cloned cDNA sequence

Length: 6958 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1070 bp
Genome contig ID gi51511732f_24549071
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTACATATTGCTCTGTTAAAGAATTTTCTCTGCC
Flanking genome sequence
(194628 - 194677)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAGAAAAAACAAAAAAACGCTTAAAGCTGGAGTTTGACATTCT

Features of the protein sequence

Length: 1961 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI72409 0 100.0 Trinucleotide r...
synthetic construct
Q8NDV7 0 99.8 Trinucleotide r...
Homo sapiens
EAW55784 0 100.0 trinucleotide r...
Homo sapiens
XP_001098210 0 98.7 similar to trin...
Macaca mulatta
EDM17539 0 94.4 trinucleotide r...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp