Length: 6958 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
1070 bp |
Genome contig ID |
gi51511732f_24549071 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- ACTACATATTGCTCTGTTAAAGAATTTTCTCTGCC |
Flanking genome sequence (194628 - 194677) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAGAAAAAACAAAAAAACGCTTAAAGCTGGAGTTTGACATTCT |
Length: 1961 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
AAI72409 |
0 |
100.0 |
Trinucleotide r...
|
synthetic construct
|
Q8NDV7 |
0 |
99.8 |
Trinucleotide r...
|
Homo sapiens
|
EAW55784 |
0 |
100.0 |
trinucleotide r...
|
Homo sapiens
|
XP_001098210 |
0 |
98.7 |
similar to trin...
|
Macaca mulatta
|
EDM17539 |
0 |
94.4 |
trinucleotide r...
|
Rattus norvegicus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.