Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11853
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11853
Clone name hf00243
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol GTF3C4
cDNA sequence DNA sequence (7548 bp)
Predicted protein sequence (819 aa)
Flexi ORF Clone FXC11853
Description General transcription factor 3C polypeptide 4 (EC 2.3.1.48)(Transcription factor IIIC subunit delta)(TF3C-delta)(TFIIIC 90 kDa subunit)(TFIIIC 90)
Features of the cloned cDNA sequence

Length: 7548 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 5086 bp
Genome contig ID gi89161216f_134435814
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TTTTTTTGAAATAAACAGAACAGTCATCTAAAAAC
Flanking genome sequence
(123433 - 123482)
----+----*----+----*----+----*----+----*----+----*
ATAAGGTTTTGGAAAGGAGATGCTTTTTCAATTCTTACCATCTGATTAGG

Features of the protein sequence

Length: 819 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9UKN8 0 100.0 General transcr...
Homo sapiens
XP_001104736 0 99.5 general transcr...
Macaca mulatta
AAF05087 0 99.2 transcription f...
Homo sapiens
XP_850535 0 95.9 similar to Gene...
Canis lupus fam...
XP_001168581 0 96.7 general transcr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp