Length: 4018 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
3131 bp |
Genome contig ID |
gi51511747f_32655803 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- AAGAAAAACAAATAAAAATATATTTAAAGCACATG |
Flanking genome sequence (109102 - 109151) |
----+----*----+----*----+----*----+----*----+----* ATCCTTTCTGCCTGAGTTGAGCTTAAGTATGAGAAGCATCTTGTAATCTT |
Length: 226 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
Q8IXH6 |
6.8e-70 |
100.0 |
Tumor protein p...
|
Homo sapiens
|
CAC82592 |
1.1e-69 |
99.5 |
hypothetical pr...
|
Homo sapiens
|
XP_001160044 |
1.2e-68 |
98.1 |
tumor protein p...
|
Pan troglodytes
|
XP_001103915 |
5.1e-67 |
96.3 |
tumor protein p...
|
Macaca mulatta
|
XP_852549 |
5.5e-62 |
89.5 |
similar to Tumo...
|
Canis lupus fam...
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.