ORK11881

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11881

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11881
Clone name	hj03768b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of KpnI site to SacI site of the vector.
Symbol	TP53INP2
cDNA sequence	DNA sequence (4018 bp) Predicted protein sequence (226 aa)
Description	Tumor protein p53-inducible nuclear protein 2 (p53-inducible protein U)(PIG-U)

Features of the cloned cDNA sequence

Description

Length: 4018 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3131 bp
Genome contig ID	gi51511747f_32655803
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAGAAAAACAAATAAAAATATATTTAAAGCACATG
Flanking genome sequence (109102 - 109151)	----+--------+--------+--------+--------+----* ATCCTTTCTGCCTGAGTTGAGCTTAAGTATGAGAAGCATCTTGTAATCTT

Features of the protein sequence

Description

Length: 226 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8IXH6	6.8e-70	100.0	Tumor protein p...	Homo sapiens
CAC82592	1.1e-69	99.5	hypothetical pr...	Homo sapiens
XP_001160044	1.2e-68	98.1	tumor protein p...	Pan troglodytes
XP_001103915	5.1e-67	96.3	tumor protein p...	Macaca mulatta
XP_852549	5.5e-62	89.5	similar to Tumo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp