ORK06140

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06140

Order Kazusa clone(s) from :

Accession No	AK226146
Product ID	ORK06140
Clone name	ah03087
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NFATC2
cDNA sequence	DNA sequence (5691 bp) Predicted protein sequence (969 aa)
Description	Nuclear factor of activated T-cells, cytoplasmic 2 (T cell transcription factor NFAT1) (NFAT pre-existing subunit) (NF-ATp).

Features of the cloned cDNA sequence

Description

Length: 5691 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2771 bp
Genome contig ID	gi51511747r_49338571
PolyA signal sequence (ATTAAA,-24)	+--------+--------+----*----+---- ATTAGTATGTTATTAAATTTTATTTTCTTACCTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTATGCTTTTTACCTGTCCTCAAAATATTACACCCCTGTTGGAATT

Features of the protein sequence

Description

Length: 969 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13469	99.7	Nuclear factor ...	Homo sapiens
AAC50887	99.6	transcription f...	Homo sapiens
XP_525356	99.4	nuclear factor ...	Pan troglodytes
CAI18853	98.9	nuclear factor ...	Homo sapiens
AAC50886	98.8	transcription f...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008366	478	494	PR01789	Nuclear factor of activated T cells (NFAT)
	IPR008366	600	622	PR01789	Nuclear factor of activated T cells (NFAT)
	IPR008366	643	662	PR01789	Nuclear factor of activated T cells (NFAT)
	IPR008366	702	721	PR01789	Nuclear factor of activated T cells (NFAT)
HMMPfam	IPR011539	454	614	PF00554	Rel homology
HMMPfam	IPR002909	622	719	PF01833	Cell surface receptor IPT/TIG
HMMSmart	IPR002909	621	720	SM00429	Cell surface receptor IPT/TIG
ProfileScan	IPR011539	436	618	PS50254	Rel homology

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp