ORK04657

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04657

Order Kazusa clone(s) from :

Accession No	AB209463
Product ID	ORK04657
Clone name	ah04235
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CSNK1D
cDNA sequence	DNA sequence (6093 bp) Predicted protein sequence (342 aa)
Description	Casein kinase I isoform delta (EC 2.7.11.1) (CKI-delta) (CKId).

Features of the cloned cDNA sequence

Description

Length: 6093 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4902 bp
Genome contig ID	gi51511734r_77693838
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACAATCGTGTAAATAATAAATTCATAATGACTTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTTTCTTCCCTCCCCTTTCCATGTGGTCTTTATTTCATCAGCTTGAGA

Features of the protein sequence

Description

Length: 342 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92700	2.7e-127	100.0	casein kinase 1...	Homo sapiens
XP_511761	3.4e-124	99.1	casein kinase 1...	Pan troglodytes
EAW89761	9.5e-104	97.0	casein kinase 1...	Homo sapiens
EAW89758	1e-103	97.0	casein kinase 1...	Homo sapiens
P48730	1.1e-103	97.0	Casein kinase I...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	5	153	PD000001	Protein kinase
HMMPfam	IPR000719	8	139	PF00069	Protein kinase
ProfileScan	IPR000719	1	169	PS50011	Protein kinase
ScanRegExp	IPR008271	16	28	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp