Length: 5909 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
| Length of 3'UTR |
282 bp |
| Genome contig ID |
gi89161199r_71090326 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- ATTAAAATCATATAGAAATAAATTATTCCTCTTCT |
Flanking genome sequence (205905 - 205856) |
----+----*----+----*----+----*----+----*----+----* TGAAGGAATAACTAGTATTACAAACAGTGGGTTAGGCAGATTCCTTACTT |
Length: 67 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92706 |
8.9e-26 |
100.0 |
methylmalonyl-C...
|
Homo sapiens
|
| XP_001147220 |
4.3e-17 |
98.0 |
similar to meth...
|
Pan troglodytes
|
| AAH20825 |
4.8e-17 |
96.1 |
Methylmalonyl C...
|
Homo sapiens
|
| XP_515538 |
4.8e-17 |
96.1 |
methylmalonyl-C...
|
Pan troglodytes
|
| Q96PE7 |
4.8e-17 |
96.1 |
Methylmalonyl-C...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.