Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06514
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209470
Product ID ORK06514
Clone name ah04927
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PSMB2
cDNA sequence DNA sequence (5654 bp)
Predicted protein sequence (249 aa)
Description Proteasome subunit beta type 2 (EC 3.4.25.1) (Proteasome component C7- I) (Macropain subunit C7-I) (Multicatalytic endopeptidase complex subunit C7-I).
Features of the cloned cDNA sequence

Length: 5654 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4902 bp
Genome contig ID gi89161185r_35708096
PolyA signal sequence
(ATTAAA,-25)
+----*----+----*----+----*----+----
ATGAATGCTTATTAAATACTGTAAATGATAAACAC
Flanking genome sequence
(99904 - 99855)
----+----*----+----*----+----*----+----*----+----*
ATCAATGGATGGTGTTATGAATCCACTGGCCTATTAAGGGATCCTTTAGG

Features of the protein sequence

Length: 249 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92707 6.6e-106 100.0 proteasome beta...
Homo sapiens
XP_001503726 2.6e-65 100.0 similar to Prot...
Equus caballus
Q9R1P3 2.6e-65 100.0 Proteasome subu...
Mus musculus
P40307 2.6e-65 100.0 Proteasome subu...
Rattus norvegicus
BAC37303 2.6e-65 100.0 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001353 34 199 PF00227 20S proteasome
ScanRegExp IPR000243 37 84 PS00854 Peptidase T1A
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp