ORK06771

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06771

Order Kazusa clone(s) from :

Accession No	AB209168
Product ID	ORK06771
Clone name	aj01034
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SEPT5
cDNA sequence	DNA sequence (4113 bp) Predicted protein sequence (394 aa)
Description	Septin-5 (Peanut-like protein 1) (Cell division control-related protein 1) (CDCrel-1).

Features of the cloned cDNA sequence

Description

Length: 4113 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1458 bp
Genome contig ID	gi89161203f_17984743
PolyA signal sequence (None)	+--------+--------+----*----+---- CCGCGACCTGCGTTGCGTGGCGCCCCCAGCGCTGC
Flanking genome sequence (106998 - 107047)	----+--------+--------+--------+--------+----* GCGGCCGCCTGCTGCCCTATCTGGCCGAGGACGAGCTGCGCGCCGCTTGC

Features of the protein sequence

Description

Length: 394 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92405	3.9e-161	100.0	H5 variant [Hom...	Homo sapiens
EAX03029	6.4e-154	100.0	hCG2002594, iso...	Homo sapiens
Q9BGQ3	1.3e-153	99.7	Septin-5.	Macaca fascicularis
XP_001166254	1.8e-153	99.7	similar to H5 v...	Pan troglodytes
XP_543545	3.8e-153	99.2	similar to Sept...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	175	222	PD002565	Cell division/GTP binding protein
HMMPfam	IPR000038	66	346	PF00735	Cell division/GTP binding protein

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp