ORK06256

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06256

Order Kazusa clone(s) from :

Accession No	AB209709
Product ID	ORK06256
Clone name	bm01495
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	P2RX7
cDNA sequence	DNA sequence (2215 bp) Predicted protein sequence (385 aa)
Description	P2X purinoceptor 7 (ATP receptor) (P2X7) (Purinergic receptor) (P2Z receptor).

Features of the cloned cDNA sequence

Description

Length: 2215 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Features of the protein sequence

Description

Length: 385 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92946	1.2e-177	100.0	P2X purinocepto...	Homo sapiens
AAX82087	1.1e-167	99.7	P2X7 isoform B ...	Homo sapiens
Q99572	6.3e-159	100.0	P2X purinocepto...	Homo sapiens
CAA73360	6.3e-159	100.0	P2X7 receptor [...	Homo sapiens
AAI21158	1.8e-158	99.7	P2RX7 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003050	22	33	PR01314	P2X7 purinoceptor
	IPR003050	55	68	PR01314	P2X7 purinoceptor
	IPR003050	69	79	PR01314	P2X7 purinoceptor
	IPR001429	107	115	PR01307	P2X purinoreceptor
	IPR001429	181	192	PR01307	P2X purinoreceptor
	IPR003050	216	225	PR01314	P2X7 purinoceptor
	IPR001429	263	275	PR01307	P2X purinoreceptor
	IPR001429	310	320	PR01307	P2X purinoreceptor
	IPR001429	329	343	PR01307	P2X purinoreceptor
HMMPfam	IPR001429	32	381	PF00864	P2X purinoreceptor
HMMTigr	IPR001429	22	379	TIGR00863	P2X purinoreceptor
ScanRegExp	IPR001429	270	296	PS01212	P2X purinoreceptor

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	50	IKWFFHVIIFSYVCFALVSDKLY	72	PRIMARY	23
SOSUI2	2	347	GKFDIIQLVVYIGSTLSYFGLVR	369	PRIMARY	23