ORK09432

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK09432

Order Kazusa clone(s) from :

Accession No
Product ID	ORK09432
Clone name	bm02369
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CYP2J2
cDNA sequence	DNA sequence (1878 bp) Predicted protein sequence (503 aa)
HaloTag ORF Clone	FHC09432
Flexi ORF Clone	FXC09432
Description	cytochrome P450, family 2, subfamily J, polypeptide 2

Features of the cloned cDNA sequence

Description

Length: 1878 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Features of the protein sequence

Description

Length: 503 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P51589	0	100.0	Cytochrome P450...	Homo sapiens
BAB85489	0	99.8	cytochrome P450...	Homo sapiens
BAG37780	0	99.6	unnamed protein...	Homo sapiens
XP_513445	3e-216	98.6	similar to cyto...	Pan troglodytes
XP_001082853	8.3e-210	94.8	similar to cyto...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008071	17	30	PR01688	Cytochrome P450
	IPR002401	73	92	PR00463	Cytochrome P450
	IPR008071	90	101	PR01688	Cytochrome P450
	IPR002401	97	118	PR00463	Cytochrome P450
	IPR002401	188	206	PR00463	Cytochrome P450
	IPR002401	301	318	PR00463	Cytochrome P450
	IPR001128	312	329	PR00385	Cytochrome P450
	IPR002401	321	347	PR00463	Cytochrome P450
	IPR002401	364	382	PR00463	Cytochrome P450
	IPR001128	365	376	PR00385	Cytochrome P450
	IPR002401	405	429	PR00463	Cytochrome P450
	IPR008071	422	437	PR01688	Cytochrome P450
	IPR002401	439	449	PR00463	Cytochrome P450
	IPR001128	440	449	PR00385	Cytochrome P450
	IPR001128	449	460	PR00385	Cytochrome P450
	IPR002401	449	472	PR00463	Cytochrome P450
	IPR008071	490	501	PR01688	Cytochrome P450
HMMPfam	IPR001128	45	499	PF00067	Cytochrome P450
ScanRegExp	IPR001128	442	451	PS00086	Cytochrome P450

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp