Length: 1463 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
260 bp |
| Genome contig ID |
gi51511721f_176706429 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- TGGCGGGAAGGACCCTCAACGTGCGTTTCCGCCAC |
Flanking genome sequence (109561 - 109610) |
----+----*----+----*----+----*----+----*----+----* AACAGAACCTAAGGGTACAGCACTAAGTCTAAGACCAACCCTTCTCCGGT |
Length: 282 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| Q8TB68 |
1.3e-92 |
100.0 |
Proline-rich pr...
|
Homo sapiens
|
| AAH21240 |
5.4e-92 |
99.6 |
PRR7 protein [H...
|
Homo sapiens
|
| XP_001090579 |
4.9e-91 |
98.1 |
similar to prol...
|
Macaca mulatta
|
| P0C6T3 |
4.1e-87 |
96.7 |
Proline-rich pr...
|
Rattus norvegicus
|
| XP_853988 |
5.8e-87 |
96.0 |
similar to prol...
|
Canis lupus fam...
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
| Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
20 |
TCFAGFWLIWGLIVLLCCFCSFL |
42 |
PRIMARY |
23 |