Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11797
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11797
Clone name ee08064
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol FAM208B
cDNA sequence DNA sequence (8961 bp)
Predicted protein sequence (2751 aa)
Description Uncharacterized protein C10orf18
Features of the cloned cDNA sequence

Length: 8961 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 704 bp
Genome contig ID gi89161187f_5666821
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGTGTTTCATTTTTTAAATAAAGACAACTAAAAAT
Flanking genome sequence
(178888 - 178937)
----+----*----+----*----+----*----+----*----+----*
AATCTCTTTCTGCAATGATTTTTATAGCAGAAATTGACTTATCTGGAGTG

Features of the protein sequence

Length: 2751 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW86433 0 99.5 hCG2042943 [Hom...
Homo sapiens
XP_507637 0 97.7 similar to chro...
Pan troglodytes
Q5VWN6 0 99.9 Uncharacterized...
Homo sapiens
BAC87251 0 99.8 unnamed protein...
Homo sapiens
XP_001917014 0 69.8 similar to hCG2...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp