Length: 8961 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
| Length of 3'UTR |
704 bp |
| Genome contig ID |
gi89161187f_5666821 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- TGTGTTTCATTTTTTAAATAAAGACAACTAAAAAT |
Flanking genome sequence (178888 - 178937) |
----+----*----+----*----+----*----+----*----+----* AATCTCTTTCTGCAATGATTTTTATAGCAGAAATTGACTTATCTGGAGTG |
Length: 2751 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| EAW86433 |
0 |
99.5 |
hCG2042943 [Hom...
|
Homo sapiens
|
| XP_507637 |
0 |
97.7 |
similar to chro...
|
Pan troglodytes
|
| Q5VWN6 |
0 |
99.9 |
Uncharacterized...
|
Homo sapiens
|
| BAC87251 |
0 |
99.8 |
unnamed protein...
|
Homo sapiens
|
| XP_001917014 |
0 |
69.8 |
similar to hCG2...
|
Equus caballus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.