ORK07203

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07203

Order Kazusa clone(s) from :

Accession No	AB209906
Product ID	ORK07203
Clone name	eh00731
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	TRIM38
cDNA sequence	DNA sequence (5882 bp) Predicted protein sequence (298 aa)
Description	Tripartite motif-containing protein 38 (RING finger protein 15) (Zinc finger protein RoRet).

Features of the cloned cDNA sequence

Description

Length: 5882 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1605 bp
Genome contig ID	gi89161210f_25971256
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGCCTGGACATAGCACCAGAGAAGTCTTTTTTTT
Flanking genome sequence (122245 - 122294)	----+--------+--------+--------+--------+----* TAAAAAAAAAAAAAAAAAAAGGGAAAGAAAAAGTTGCCTTCCCACAATTT

Features of the protein sequence

Description

Length: 298 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93143	8.4e-130	100.0	tripartite moti...	Homo sapiens
AAH26930	5.7e-129	99.6	Tripartite moti...	Homo sapiens
O00635	5.7e-129	99.6	Tripartite moti...	Homo sapiens
ACE86652	5.7e-129	99.6	tripartite moti...	synthetic construct
BAG36059	2.4e-128	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR003879	123	140	PR01407	Butyrophylin-like
	IPR003879	140	157	PR01407	Butyrophylin-like
	IPR003879	162	186	PR01407	Butyrophylin-like
	IPR003879	192	205	PR01407	Butyrophylin-like
	IPR003879	236	260	PR01407	Butyrophylin-like
	IPR003879	267	285	PR01407	Butyrophylin-like
HMMPfam	IPR003877	177	297	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR006574	124	176	SM00589	SPRY-associated
HMMSmart	IPR003877	177	297	SM00449	SPla/RYanodine receptor SPRY
ProfileScan	IPR001870	107	298	PS50188	B302

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp