ORK07223

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07223

Order Kazusa clone(s) from :

Accession No	AB209489
Product ID	ORK07223
Clone name	ff03077
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TRRAP
cDNA sequence	DNA sequence (11651 bp) Predicted protein sequence (3587 aa)
Description	Transformation/transcription domain-associated protein (350/400 kDa PCAF-associated factor) (PAF350/400) (STAF40) (Tra1 homolog).

Features of the cloned cDNA sequence

Description

Length: 11651 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	885 bp
Genome contig ID	gi89161213f_98236239
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GATTTTTTTTTTTAGAATAAATATTTTATAAAAGG
Flanking genome sequence (212562 - 212611)	----+--------+--------+--------+--------+----* GTTTATTGTCCCTTGTTTATGTTAAAATGCTTGTTTCCATGAGGGGTTTC

Features of the protein sequence

Description

Length: 3587 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92726	100.0	Transformation/...	Homo sapiens
XP_850245	99.2	similar to Tran...	Canis lupus fam...
EAW76695	99.2	transformation/...	Homo sapiens
Q9Y4A5	98.9	Transformation/...	Homo sapiens
AAD04629	98.9	PCAF-associated...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003151	2570	2914	PF02259	PIK-related kinase
HMMPfam	IPR000403	3267	3414	PF00454	Phosphatidylinositol 3- and 4-kinase
HMMSmart	IPR000403	3267	3556	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR014009	2425	2985	PS51189	PIK-related kinase
	IPR000403	3256	3467	PS50290	Phosphatidylinositol 3- and 4-kinase
	IPR003152	3555	3587	PS51190	PIK-related kinase
ScanRegExp	IPR000923	2371	2385	PS00196	Blue (type 1) copper domain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp