Length: 4482 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
3086 bp |
Genome contig ID |
gi51511731r_27099748 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- TGATCCGTGTTTTAATAAAAAGAAGTATTTCTGGC |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* CTCTGTGTCTCTGAGGTCTAACTGGGACAGAGGCAGGCTGAGAGGCTGTG |
Length: 464 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
NP_056122 |
9.3e-136 |
99.5 |
hypothetical pr...
|
Homo sapiens
|
EAW51514 |
7.6e-129 |
99.0 |
hCG27623 [Homo ...
|
Homo sapiens
|
XP_001115936 |
1.7e-123 |
94.4 |
hypothetical pr...
|
Macaca mulatta
|
XP_002194890 |
9e-64 |
55.1 |
hypothetical pr...
|
Taeniopygia guttata
|
AAI21477 |
2.7e-63 |
53.1 |
hypothetical pr...
|
Xenopus (Silura...
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
16 |
LVITFFMLLSAVCVMLNLAGSIL |
38 |
PRIMARY |
23 |
2 |
102 |
LFSVCALNVLSTIVCALATAMCC |
124 |
PRIMARY |
23 |