Length: 6941 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
4641 bp |
Genome contig ID |
gi51511721f_178992458 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- TCCTAGTCTCTATCATTAAAGTTCTAGTGACCGAG |
Flanking genome sequence (163662 - 163711) |
----+----*----+----*----+----*----+----*----+----* ACCCGGGCTGCGTTCTCTGGGTCCGCGGGGGTGGCGCACCGCGGGCTACG |
Length: 761 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92372 |
0 |
100.0 |
mastermind-like...
|
Homo sapiens
|
Q92585 |
8.7e-174 |
97.3 |
Mastermind-like...
|
Homo sapiens
|
XP_527150 |
1.6e-170 |
96.3 |
mastermind-like...
|
Pan troglodytes
|
XP_001105097 |
3.4e-168 |
94.4 |
mastermind-like...
|
Macaca mulatta
|
AAF34658 |
7.5e-161 |
98.4 |
Mam1 [Homo sapi...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.