Length: 5160 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
578 bp |
| Genome contig ID |
gi51511732f_2413144 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- TCGGGAGCCCTGCTGGATTGATGCCCAGGGCCTGT |
Flanking genome sequence (106543 - 106592) |
----+----*----+----*----+----*----+----*----+----* GCGGCCGCCCTGGAGGCGGTGGCTGGGATAAACGTGCACCCAGCAGGACT |
Length: 192 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92588 |
5.9e-75 |
100.0 |
CGI-14 protein ...
|
Homo sapiens
|
| XP_510749 |
3.1e-64 |
100.0 |
amidohydrolase ...
|
Pan troglodytes
|
| XP_001163434 |
4e-64 |
95.5 |
similar to amid...
|
Pan troglodytes
|
| XP_001163691 |
9.3e-64 |
100.0 |
amidohydrolase ...
|
Pan troglodytes
|
| AAH18734 |
9.3e-64 |
100.0 |
Amidohydrolase ...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.