ORK05028

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05028

Order Kazusa clone(s) from :

Accession No	AB209352
Product ID	ORK05028
Clone name	fh14375
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FKBP9
cDNA sequence	DNA sequence (5179 bp) Predicted protein sequence (194 aa)
Description	FK506-binding protein 9 precursor (EC 5.2.1.8) (Peptidyl-prolyl cis- trans isomerase) (PPIase) (Rotamase).

Features of the cloned cDNA sequence

Description

Length: 5179 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4068 bp
Genome contig ID	gi89161213r_55616265
PolyA signal sequence (TATAAA,-18)	+--------+--------+----*----+---- AAGCTGATCTTTTCTGATATAAAATGTTGAATGAT
Flanking genome sequence (211016 - 210967)	----+--------+--------+--------+--------+----* ATACAAAATAAAAACAAAACCTTTTTATTGTGCATCACAGGAAGGCGCTT

Features of the protein sequence

Description

Length: 194 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92589	3.3e-85	100.0	FK506 binding p...	Homo sapiens
XP_519033	3e-72	100.0	similar to FK50...	Pan troglodytes
AAH64418	2e-69	97.6	FKBP9 protein [...	Homo sapiens
XP_532509	3.4e-69	97.6	similar to FK50...	Canis lupus fam...
AAC78853	3.4e-69	97.6	FK506-binding p...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001179	56	150	PF00254	Peptidyl-prolyl cis-trans isomerase
ProfileScan	IPR001179	65	153	PS50059	Peptidyl-prolyl cis-trans isomerase
ProfileScan	IPR002048	164	194	PS50222	Calcium-binding EF-hand

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp