ORK05343

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05343

Order Kazusa clone(s) from :

Accession No	AB209362
Product ID	ORK05343
Clone name	fh16565
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GPR156
cDNA sequence	DNA sequence (5780 bp) Predicted protein sequence (539 aa)
Description	Probable G-protein coupled receptor 156 (GABAB-related G-protein coupled receptor) (G-protein coupled receptor PGR28).

Features of the cloned cDNA sequence

Description

Length: 5780 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3974 bp
Genome contig ID	gi89161205r_121262962
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TTGTTGAATAAAAATAAGTAGATAAAAAGTCTTAC
Flanking genome sequence (99784 - 99735)	----+--------+--------+--------+--------+----* AAAGGAAAACACAGATTTATATGCAGAAATCCTCTTTATGTTTTCTTGTG

Features of the protein sequence

Description

Length: 539 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92599	4.8e-189	100.0	G protein-coupl...	Homo sapiens
Q8NFN8	2.4e-172	98.8	Probable G-prot...	Homo sapiens
EAW79530	4.9e-172	98.6	G protein-coupl...	Homo sapiens
XP_001164405	2.4e-171	98.0	G protein-coupl...	Pan troglodytes
XP_001110586	3.7e-157	90.6	similar to G pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR002016	134	144	PS00435	Haem peroxidase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp