ORK06390

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06390

Order Kazusa clone(s) from :

Accession No	AB209374
Product ID	ORK06390
Clone name	fh17552
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PLD2
cDNA sequence	DNA sequence (5062 bp) Predicted protein sequence (282 aa)
Description	Phospholipase D2 (EC 3.1.4.4) (PLD 2) (Choline phosphatase 2) (Phosphatidylcholine-hydrolyzing phospholipase D2) (PLD1C) (hPLD2).

Features of the cloned cDNA sequence

Description

Length: 5062 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	566 bp
Genome contig ID	gi51511734f_4557836
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CAATAAGCATTTCATAAATAAAGGTGTAGAAAAGG
Flanking genome sequence (115858 - 115907)	----+--------+--------+--------+--------+----* TTCATGCGTCTTCCTTGGAGGAACTAACTGCTCGTTCCAGCCTCCCGTTC

Features of the protein sequence

Description

Length: 282 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92611	4.2e-129	100.0	phospholipase D...	Homo sapiens
O14939	8.9e-119	94.5	Phospholipase D...	Homo sapiens
AAD04197	8.9e-119	94.5	phospholipase D...	Homo sapiens
AAH56871	8.9e-119	94.5	Phospholipase D...	Homo sapiens
AAH15033	8.9e-119	94.5	Phospholipase D...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001736	100	127	PF00614	Phospholipase D/Transphosphatidylase
HMMSmart	IPR001736	100	127	SM00155	Phospholipase D/Transphosphatidylase
ProfileScan	IPR001736	100	127	PS50035	Phospholipase D/Transphosphatidylase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp