Length: 5689 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
4529 bp |
| Genome contig ID |
gi89161210r_117888133 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- ATCTCATTTTTTTAAATAAACATTTTGTTTCCTTG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* ACGTTAAATATTTTGGCTTGTTATTTATTTCTAGTAGTTCTATTATTTGT |
Length: 362 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92622 |
5.9e-122 |
100.0 |
golgi associate...
|
Homo sapiens
|
| Q9HD26 |
2.1e-100 |
100.0 |
Golgi-associate...
|
Homo sapiens
|
| XP_518712 |
4e-100 |
99.6 |
golgi associate...
|
Pan troglodytes
|
| XP_001109778 |
7.4e-100 |
99.3 |
golgi associate...
|
Macaca mulatta
|
| Q5RD32 |
4.4e-99 |
98.6 |
Golgi-associate...
|
Pongo abelii
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.