ORK07595

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07595

Order Kazusa clone(s) from :

Accession No	AB209215
Product ID	ORK07595
Clone name	fj10530
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ZNF207
cDNA sequence	DNA sequence (4672 bp) Predicted protein sequence (496 aa)
Description	Homo sapiens mRNA for zinc finger protein 207 variant protein.

Features of the cloned cDNA sequence

Description

Length: 4672 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3084 bp
Genome contig ID	gi51511734f_27601312
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCTTGGGTGACAGAGCGAGACTCCGTCTC
Flanking genome sequence (130778 - 130827)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGAAAAAAAGAAAAAGTGATAAGATTTGGGAGTCTATTCC

Features of the protein sequence

Description

Length: 496 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92452	6.8e-132	100.0	zinc finger pro...	Homo sapiens
XP_001113013	3.1e-131	100.0	similar to zinc...	Macaca mulatta
EAW80231	1.9e-130	100.0	zinc finger pro...	Homo sapiens
EDM05418	2.4e-129	99.1	rCG33491, isofo...	Rattus norvegicus
Q5R8K4	3.7e-129	98.9	Zinc finger pro...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	NULL	142	154	PR01217	NULL
	NULL	157	173	PR01217	NULL
	NULL	210	231	PR01217	NULL
	NULL	231	247	PR01217	NULL
	NULL	255	272	PR01217	NULL
	NULL	330	355	PR01217	NULL
HMMSmart	IPR015880	14	37	SM00355	Zinc finger
HMMSmart	IPR015880	38	61	SM00355	Zinc finger
ScanRegExp	IPR007087	16	37	PS00028	Zinc finger
ScanRegExp	IPR007087	40	61	PS00028	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp