ORK04052

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04052

Order Kazusa clone(s) from :

Accession No	AB209227
Product ID	ORK04052
Clone name	fj13316
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ADD2
cDNA sequence	DNA sequence (3776 bp) Predicted protein sequence (583 aa)
Description	Beta-adducin (Erythrocyte adducin subunit beta).

Features of the cloned cDNA sequence

Description

Length: 3776 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1616 bp
Genome contig ID	gi89161199r_70655733
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATAGAAGGGATTGCAATAAAGGTGTGTCTTCCTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCTCGGGAGCATCCTTTGATTTTATTTCAGGGGCAGACTGTGGACCCCC

Features of the protein sequence

Description

Length: 583 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92464	0	100.0	adducin 2 isofo...	Homo sapiens
BAG59729	0	99.6	unnamed protein...	Homo sapiens
EAW99801	0	100.0	adducin 2 (beta...	Homo sapiens
AAP71863	8.5e-215	97.2	beta adducin 2 ...	Homo sapiens
AAH41666	9.2e-215	97.2	Adducin 2 (beta...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001303	159	358	PF00596	Class II aldolase/adducin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp