Length: 3851 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
Length of 3'UTR |
1183 bp |
Genome contig ID |
gi89161213f_86519695 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- ATTCAGTTTAACAGAAATAAAAGAATATTTGTCTT |
Flanking genome sequence (143882 - 143931) |
----+----*----+----*----+----*----+----*----+----* AAGATGCAAGATTTGTTTTTACATAGCCTTTTGCCATACAATTATAAAAA |
Length: 377 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92467 |
6e-139 |
100.0 |
Cyclin-D bindin...
|
Homo sapiens
|
EAW76962 |
5.3e-132 |
96.0 |
cyclin D bindin...
|
Homo sapiens
|
BAG54353 |
5.3e-132 |
96.0 |
unnamed protein...
|
Homo sapiens
|
AAH07418 |
5.5e-132 |
96.0 |
DMTF1 protein [...
|
Homo sapiens
|
BAG58937 |
6.8e-132 |
96.0 |
unnamed protein...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.