Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK11816
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK11816
Clone name fj19852
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol KIAA0408
cDNA sequence DNA sequence (4364 bp)
Predicted protein sequence (730 aa)
Description Uncharacterized protein KIAA0408
Features of the cloned cDNA sequence

Length: 4364 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 405 bp
Genome contig ID gi89161210r_127706543
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTGTTGACTTTGAAATTATAACATGTATACCTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATATTCTTTGTGTTTATTTAAAAGTTTTGAAAATATGCAGTACTGTTTAT

Features of the protein sequence

Length: 730 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001106088 0 93.8 similar to Temp...
Macaca mulatta
CAB65988 0 100.0 chromosome 6 op...
Homo sapiens
BAE02197 7.3e-189 94.4 unnamed protein...
Macaca fascicularis
XP_001789772 1.4e-131 70.8 hypothetical pr...
Bos taurus
EDL87692 1.4e-91 57.4 rCG42077, isofo...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp