Length: 4364 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end
Length of 3'UTR |
405 bp |
Genome contig ID |
gi89161210r_127706543 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- AGTGTTGACTTTGAAATTATAACATGTATACCTAT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* ATATTCTTTGTGTTTATTTAAAAGTTTTGAAAATATGCAGTACTGTTTAT |
Length: 730 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
XP_001106088 |
0 |
93.8 |
similar to Temp...
|
Macaca mulatta
|
CAB65988 |
0 |
100.0 |
chromosome 6 op...
|
Homo sapiens
|
BAE02197 |
7.3e-189 |
94.4 |
unnamed protein...
|
Macaca fascicularis
|
XP_001789772 |
1.4e-131 |
70.8 |
hypothetical pr...
|
Bos taurus
|
EDL87692 |
1.4e-91 |
57.4 |
rCG42077, isofo...
|
Rattus norvegicus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.