Length: 4252 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
| Length of 3'UTR |
0 bp |
| Genome contig ID |
gi89161218r_76696304 |
PolyA signal sequence (AAGAAA,-20) |
+----*----+----*----+----*----+---- AGAAAGCAGAGTTGGAAGAAAATCAGCGGAGCTAT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAACAGAAAAAGAAAAGGCGACGTATTAAGGTTCAAGAAGATTCATCCAG |
Length: 1384 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92165 |
0 |
100.0 |
transcriptional...
|
Homo sapiens
|
| XP_001099572 |
0 |
97.9 |
similar to tran...
|
Macaca mulatta
|
| XP_860092 |
0 |
86.2 |
similar to tran...
|
Canis lupus fam...
|
| BAC81110 |
0 |
95.1 |
ATRX [Homo sapi...
|
Homo sapiens
|
| EAW98612 |
0 |
95.0 |
alpha thalassem...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.