ORK07608

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07608

Order Kazusa clone(s) from :

Accession No	AB208892
Product ID	ORK07608
Clone name	fk00979
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	HDGFRP2
cDNA sequence	DNA sequence (3100 bp) Predicted protein sequence (472 aa)
Description	hepatoma-derived growth factor-related protein 2 isoform 2

Features of the cloned cDNA sequence

Description

Length: 3100 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1680 bp
Genome contig ID	gi42406306f_4326442
PolyA signal sequence (TATAAA,-19)	+--------+--------+----*----+---- ACCAACATGAAATGACTATAAACGGTTTTTTAATG
Flanking genome sequence (126773 - 126822)	----+--------+--------+--------+--------+----* AAAAAAGAAATCACTTTTATTGGCTTGGTTTTCTAGCATTGCTGGTGCAG

Features of the protein sequence

Description

Length: 472 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92129	5.6e-127	100.0	hepatoma-derive...	Homo sapiens
AAH00755	1.9e-101	100.0	Hepatoma-derive...	Homo sapiens
Q7Z4V5	1.9e-101	100.0	Hepatoma-derive...	Homo sapiens
XP_542154	1.1e-85	87.9	similar to hepa...	Canis lupus fam...
AAH09449	3.4e-85	100.0	MGC2641 protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000313	1	27	PF00855	PWWP

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp