ORK04337

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04337

Order Kazusa clone(s) from :

Accession No	AK226149
Product ID	ORK04337
Clone name	fk10391
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	C1QTNF6
cDNA sequence	DNA sequence (3455 bp) Predicted protein sequence (272 aa)
Description	Complement C1q tumor necrosis factor-related protein 6 precursor.

Features of the cloned cDNA sequence

Description

Length: 3455 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2018 bp
Genome contig ID	gi89161203r_35806157
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TGCCGTCCAGCATGATTAAAGAATGCTGTCTCCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTGGCGATTCAGACTGGTTCTTTCTGCTCGGCTCCCTCTGCCCACTCTGC

Features of the protein sequence

Description

Length: 272 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAG30337	5e-108	97.3	dJ151B14.4 [Hom...	Homo sapiens
AAH20551	2.2e-107	97.0	C1q and tumor n...	Homo sapiens
AAQ88740	2.9e-107	100.0	CTRP6 [Homo sap...	Homo sapiens
AAK17966	8.5e-107	96.6	complement-c1q ...	Homo sapiens
Q9BXI9	1.3e-106	99.6	Complement C1q ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR008161	91	123	PD000007	Collagen helix repeat
FPrintScan	IPR001073	150	176	PR00007	Complement C1q protein
	IPR001073	177	196	PR00007	Complement C1q protein
	IPR001073	222	243	PR00007	Complement C1q protein
	IPR001073	258	268	PR00007	Complement C1q protein
HMMPfam	IPR008160	91	132	PF01391	Collagen triple helix repeat
HMMPfam	IPR001073	139	267	PF00386	Complement C1q protein
HMMSmart	IPR001073	130	270	SM00110	Complement C1q protein
ProfileScan	IPR001073	133	272	PS50871	Complement C1q protein

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	9	LFQVTMVTAALGPVWAALLLFLL	31	PRIMARY	23