Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK00065
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK00065
Clone name ha00458
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of th ...
Symbol TET3
cDNA sequence DNA sequence (3185 bp)
Predicted protein sequence (940 aa)
Description Uncharacterized protein KIAA0401.
Features of the cloned cDNA sequence

Length: 3185 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 361 bp
Genome contig ID gi89161199f_74061132
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTATCCTTGTATATCACAATAATGGAAAGAGTTTT
Flanking genome sequence
(122043 - 122092)
----+----*----+----*----+----*----+----*----+----*
TATAGTATCCTTTCACAAAGGAGTAGTTTTAAATTCCATTTAAAATGTGT

Features of the protein sequence

Length: 940 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O43151 0 100.0 Probable methyl...
Homo sapiens
EAW99702 0 100.0 hCG40738 [Homo ...
Homo sapiens
XP_515553 0 99.3 similar to MGC2...
Pan troglodytes
XP_001107194 0 97.8 similar to CXXC...
Macaca mulatta
XP_001917149 0 93.6 similar to hCG4...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp