Length: 3185 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
361 bp |
Genome contig ID |
gi89161199f_74061132 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- CTATCCTTGTATATCACAATAATGGAAAGAGTTTT |
Flanking genome sequence (122043 - 122092) |
----+----*----+----*----+----*----+----*----+----* TATAGTATCCTTTCACAAAGGAGTAGTTTTAAATTCCATTTAAAATGTGT |
Length: 940 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
O43151 |
0 |
100.0 |
Probable methyl...
|
Homo sapiens
|
EAW99702 |
0 |
100.0 |
hCG40738 [Homo ...
|
Homo sapiens
|
XP_515553 |
0 |
99.3 |
similar to MGC2...
|
Pan troglodytes
|
XP_001107194 |
0 |
97.8 |
similar to CXXC...
|
Macaca mulatta
|
XP_001917149 |
0 |
93.6 |
similar to hCG4...
|
Equus caballus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.