Length: 6423 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
2224 bp |
Genome contig ID |
gi51511732f_4737458 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- TATAAAGCAATTCAATAAATTGTTTCAAGGTTTCC |
Flanking genome sequence (134902 - 134951) |
----+----*----+----*----+----*----+----*----+----* AAAACATTTTTTCTCACTCTTTTCTTTCTACCATGTGGAAGTAAGTAGTT |
Length: 1139 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
Q9NPG3 |
0 |
100.0 |
Ubinuclein-1; U...
|
Homo sapiens
|
XP_001169902 |
0 |
99.7 |
ubinuclein 1 is...
|
Pan troglodytes
|
AAF31755 |
0 |
99.7 |
ubinuclein [Hom...
|
Homo sapiens
|
XP_001169816 |
0 |
99.7 |
ubinuclein 1 is...
|
Pan troglodytes
|
XP_001099538 |
0 |
97.3 |
ubinuclein 1 is...
|
Macaca mulatta
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.