Length: 5900 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
788 bp |
| Genome contig ID |
gi89161190f_3370740 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- GACTCCGTGGGCGCTCAATAAACACACATGAGAAC |
Flanking genome sequence (202659 - 202708) |
----+----*----+----*----+----*----+----*----+----* AAACTGGTGGGATGGCTGGTTCCTGGTGCTGTGAAGTGGGAGGGCTGGGG |
Length: 269 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92264 |
5.7e-125 |
100.0 |
Protein arginin...
|
Homo sapiens
|
| AAF91390 |
2.5e-117 |
99.6 |
arginine N-meth...
|
Homo sapiens
|
| XP_001155953 |
2.8e-117 |
99.6 |
HMT1 hnRNP meth...
|
Pan troglodytes
|
| XP_508936 |
2.8e-117 |
99.6 |
HMT1 hnRNP meth...
|
Pan troglodytes
|
| XP_001156280 |
2.9e-117 |
99.6 |
HMT1 hnRNP meth...
|
Pan troglodytes
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.