Length: 5066 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
Length of 3'UTR |
1121 bp |
Genome contig ID |
gi89161185r_1596135 |
PolyA signal sequence (ATTAAA,-24) |
+----*----+----*----+----*----+---- AAATTTGTAGAATTAAATCATTTTCCTTGTTGTGG |
Flanking genome sequence (27900 - 27851) |
----+----*----+----*----+----*----+----*----+----* AGGAAAGAGCTGTGTTTTCTCCGTGACTTGCCAGGGCATCTTCGGGTGCC |
Length: 360 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92332 |
1e-90 |
100.0 |
cell division c...
|
Homo sapiens
|
AAC72086 |
5.6e-81 |
95.9 |
PITSLRE protein...
|
Homo sapiens
|
AAC95300 |
1.7e-80 |
95.6 |
PITSLRE protein...
|
Homo sapiens
|
CAI20033 |
1.4e-79 |
94.7 |
cell division c...
|
Homo sapiens
|
BAG64496 |
3.5e-79 |
97.5 |
unnamed protein...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.