Length: 4006 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end
Length of 3'UTR |
2087 bp |
Genome contig ID |
gi42406306r_18314475 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- ACTTTTTTCATTCTCCAATAAATTTCACTGAACTG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AACCTGGCAGCCCAGGCTGCCTGGCTGGTGTGTGTGGTGTGTGGGTGTTG |
Length: 565 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92031 |
5.9e-190 |
100.0 |
elongation fact...
|
Homo sapiens
|
EAW84707 |
1.8e-188 |
100.0 |
elongation fact...
|
Homo sapiens
|
P55199 |
3.7e-188 |
98.9 |
RNA polymerase ...
|
Homo sapiens
|
BAF85794 |
3.7e-188 |
98.9 |
unnamed protein...
|
Homo sapiens
|
AAB34056 |
5.6e-188 |
98.7 |
MEN chimeric tr...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
Search method |
interpro_ID |
From |
To |
Entry |
Definition |
HMMPfam |
IPR010844 |
457 |
558 |
PF07303 |
Occludin and RNA polymerase II elongation factor ELL |